Network Security Internet Technology Development Database Servers Mobile Phone Android Software Apple Software Computer Software News IT Information

In addition to Weibo, there is also WeChat

Please pay attention

WeChat public account

Shulou

What is the use of KEGG API

2026-07-04 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Internet Technology >

Share

Shulou(Shulou.com)06/01 Report--

What is the use of KEGG API, many novices are not very clear about this, in order to help you solve this problem, the following editor will explain for you in detail, people with this need can come to learn, I hope you can gain something.

Get

Returns a specific record based on the kegg identifier provided, with a + connection between multiple identifiers, with a maximum of 10 identifiers allowed at a time, in the following format

Http://rest.kegg.jp/get/dbentries[/option]

Dbentries = KEGG database entries of the following database

Database = pathway | brite | module | ko | genome | org | vg | ag | compound |

Glycan | reaction | rclass | enzyme | network | variant | disease | drug | dgroup | environ | disease_ja | drug_ja | dgroup_ja | environ_ja | compound_ja

Option = aaseq | ntseq | mol | kcf | image | conf | kgml | json

There are two uses

The first usage, without any option, returns a result similar to that of the web version

Example: return information about hsa:10458 gene

Http://rest.kegg.jp/get/hsa:10458

ENTRY 10458 CDS T01001NAME BAIAP2, BAP2, FLAF3 IRSP53DEFINITION (RefSeq) BAI1 associated protein 2ORTHOLOGY K05627 BAI1-associated protein 2ORGANISM hsa Homo sapiens (human) PATHWAY hsa04520 Adherens junction hsa04810 Regulation of actin cytoskeletonBRITE KEGG Orthology (KO) [BR:hsa00001] Cellular Processes Cellular community-eukaryotes 04520 Adherens junction 10458 (BAIAP2) Cell motility 04810 Regulation of actin cytoskeleton 10458 (BAIAP2) Membrane trafficking [BR:hsa04131] Endocytosis Bin/Amphiphysin/Rvs (BAR) family proteins I-BAR proteins 10458 (BAIAP2) POSITION 17q25.3.

The second use, followed by the options operation, is to note that a particular database has a specific option.

For gene database, it supports aaseq and ntseq, and returns the sequence of genes.

Example: return the nucleic acid sequence of a gene

Http://rest.kegg.jp/get/hsa:10458/ntseq

> hsa:10458 K05627 BAI1-associated protein 2 | (RefSeq) BAIAP2, BAP2, FLAF3, IRSP53; BAI1 associated protein 2 (N) atgtctctgtctcgctcagaggagatgcaccggctcacggaaaatgtctataagaccatcatggagcagttcaaccctagcctccggaacttcatcgccatggggaagaattacgagaaggcactggcaggtgtgacgtatgcagccaaaggctactttgacgccctggtgaagatgggggagctggccagcgagagccagggctccaaagaactcggagacgttctcttccagatggctgaagtccacaggcagatccagaatcagctggaagaaatgctgaagtcttttcacaacgagctgcttacgcagctggagcagaaggtggagctgga

For pathway databases, image, conf and kgml are supported, but only one record can be queried at a time

Example: return the path diagram of hsa05130

Http://rest.kegg.jp/get/hsa05130/image

For compound, glycan and drus databases, images, mcol and kcf operations are supported. For images, only one record is allowed to be returned at a time.

Example: return the structure diagram of C00002

Http://rest.kegg.jp/get/C00002/image

Conv

Convert ID of kegg and ID of other databases

The first format, the conversion between all records

Http://rest.kegg.jp/conv/target_db/source_db

(target_db source_db) = (kegg_db outside_db) | (outside_db kegg_db)

For gene identifiers:

Kegg_d > = org

Org = KEGG organism code or T number

Outside_d > = ncbi-geneid | ncbi-proteinid | uniprot

For chemical substance identifiers:

Kegg_db = compound | glycan | drug

Outside_db = pubchem | chebi

Example: conversion between ncbi entrez ID of human and ID of kegg

Http://rest.kegg.jp/conv/hsa/ncbi-geneid

Ncbi-geneid:1 hsa:1ncbi-geneid:10 hsa:10ncbi-geneid:100 hsa:100ncbi-geneid:1000 hsa:1000ncbi-geneid:100008587 hsa:100008587ncbi-geneid:100008588 hsa:100008588ncbi-geneid:100008589 hsa:100008589ncbi-geneid:100009667 hsa:100009667ncbi-geneid:100009676 hsa:100009676

In the second format, the conversion between several records is the same as the first, except that the corresponding relationship between several records is returned at a time. Multiple records are connected with +, and a maximum of 10 records are allowed at a time.

For example, query the ncbi protein id corresponding to hsa:10458 and ece:Z5100 genes

Http://rest.kegg.jp/conv/ncbi-proteinid/hsa:10458+ece:Z5100

Hsa:10458 ncbi-proteinid:NP_059345ece:Z5100 ncbi-proteinid:AAG58814link

There are two uses for retrieving the association between two databases

First, the association between two databases

Http://rest.kegg.jp/link/target_db/source_db

Target_db = database

Source_db = database

Database = pathway | brite | module | ko | genome | org | vg | ag | compound |

Glycan | reaction | rclass | enzyme | network | variant | disease | drug | dgroup | environ | atc | jtc | ndc | yj | pubmed

Example: correspondence between human gene and pathway

Http://rest.kegg.jp/link/pathway/hsa

Hsa:10327 path:hsa00010hsa:124 path:hsa00010hsa:125 path:hsa00010hsa:126 path:hsa00010hsa:127 path:hsa00010hsa:128 path:hsa00010hsa:130 path:hsa00010

Second, query the association of several records between the two databases

Example: query the pathway information corresponding to hsa:10458 and ece:Z5100 genes

Http://rest.kegg.jp/link/pathway/hsa:10458+ece:Z5100

Hsa:10458 path:hsa04520hsa:10458 path:hsa04810ece:Z5100 path:ece05130ddi

To find the interaction between drugs, the URL format is as follows

Http://rest.kegg.jp/ddi/dbentry

Dbentry = Single entry of the following database

Database = drug | ndc | yj

ID can be provided for 1 drug, or multiple ID can be provided at a time, with + connections.

Example: query the record of interaction with D005664

Http://rest.kegg.jp/ddi/D00564

Dr:D00564 cpd:C00304 P unclassifieddr:D00564 cpd:C01946 P unclassifieddr:D00564 cpd:C04931 P unclassifieddr:D00564 cpd:C05849 P unclassified

Kegg API allows us to easily access a variety of resources, the biggest advantage is that we can download a batch through the program, such as a species-owned pathway road map or kgml file.

Is it helpful for you to read the above content? If you want to know more about the relevant knowledge or read more related articles, please follow the industry information channel, thank you for your support.

Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.

Views: 0

*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

Share To

Internet Technology

Wechat

© 2024 shulou.com SLNews company. All rights reserved.

12
Report