In addition to Weibo, there is also WeChat
Please pay attention

WeChat public account
Shulou
2026-07-04 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Internet Technology >
Share
Shulou(Shulou.com)06/01 Report--
This article is to share with you about what tool SSRIT is. The editor thinks it is very practical, so share it with you as a reference and follow the editor to have a look.
Microsatellite microsatellite, also known as simple repeat sequence (simple sequence repeats, SSR) or short tandem repeat sequence (short tandem repeats, STR), refers to a DNA sequence that is repeated many times in units from 2 to 10bp.
The smallest unit of repetition is called motif, and the example is as follows
Agagagagagag
The above fragment is a SSR sequence and motif is ag, which has been repeated for 6 times.
There are many species and wide distribution of microsatellite DNA, and there is one repeat sequence on average 50bp in the genome; the repeat units and repeat times are very different in different races and different populations, which constitute the genetic polymorphism of SSR.
SSRIT is a software that identifies simple repeating series. The official website is as follows:
Http://archive.gramene.org/db/markers/ssrtool
The official website of the software provides online services, and the usage is as follows
The first step is to select the minimum length and minimum number of repeats of the motif
Parameter an is used to select the minimum length of motif, which can be selected from 2 to 10 BP. Parameter b is used to select the minimum number of repetitions, which is recommended to be more than 5.
The second step is to enter the sequence in fasta format
In the text box, enter the sequence in fasta format, and then click FIND SSRs in the lower right corner to submit.
The output is as follows
The first column is the ID of the SSR region, which is composed of a sequence identifier and a numerical number, the second column is the base sequence of the Motif, the third column is the number of repeats, the fourth column and the fifth column correspond to the starting and ending positions of the SSR region, and the sixth column is the total length of the input sequence.
You can also download the script and run it locally. The installation process is as follows
Wget ftp://ftp.gramene.org/pub/gramene/archives/software/scripts/ssr.pl
The software is developed in Perl language, and you can download the corresponding perl script directly. This perl script is relatively crude and does not provide information such as help documentation. As you can see from the source code, the usage is as follows
Perl ssr.pl input.fasta > ssr.txt
You only need to provide an input file in fasta format. You can provide multiple fasta files at a time. The example files are as follows
> seq1agagattaggatcgatcgcgctctctctctctctctcgatcgagatcgatggccatcatcatcatcatcattgagatatagcgcgatatcgagagatctcagaatagatatcgcgctatagagagatcgagagagagtaga > seq2agagataggaatatgagatagcgggggggggggggcgctatacgcgctcggagagagatctctctctctcttatagagatcgatcgactagctagatataagactcactcactcactcactcactcagcgcgat
The output is saved in the ssr.txt file by redirection, which contains the following
Seq1 13 cat 6 54 71 141seq2 14 actc 6 103 126 134
The output is basically the same as the online service, and the second and third columns do not need to be read. It should be noted that for the same input file, the online service identified four SSR areas, while the local version identified only two, due to different parameter settings.
The local version of motif length and repeat number can only be achieved by modifying the source code, the corresponding code is as follows
My @ specs = ([2Jing 9], # dinucl. With > = 9 repeats [3pr 6], # trinucl. With > = 6 repeats [4pr 5]); # tetranucl. With > = 5 repeats
By default, for the motif of 2bp, the minimum number of repeats is 9, and the motif of ct appears only 8 times, so it is filtered out. If you want to be consistent with the official website, you can modify the source code and run it again.
Thank you for reading! This is the end of this article on "what is SSRIT?". I hope the above content can be of some help to you, so that you can learn more knowledge. if you think the article is good, you can share it for more people to see!
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

The market share of Chrome browser on the desktop has exceeded 70%, and users are complaining about
The world's first 2nm mobile chip: Samsung Exynos 2600 is ready for mass production.According to a r
A US federal judge has ruled that Google can keep its Chrome browser, but it will be prohibited from
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope





About us Contact us Product review car news thenatureplanet
More Form oMedia: AutoTimes. Bestcoffee. SL News. Jarebook. Coffee Hunters. Sundaily. Modezone. NNB. Coffee. Game News. FrontStreet. GGAMEN
© 2024 shulou.com SLNews company. All rights reserved.