Network Security Internet Technology Development Database Servers Mobile Phone Android Software Apple Software Computer Software News IT Information

In addition to Weibo, there is also WeChat

Please pay attention

WeChat public account

Shulou

How to use SNP2CAPS in perl

2026-07-01 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >

Share

Shulou(Shulou.com)06/01 Report--

This article will explain in detail how to use SNP2CAPS in perl. The editor thinks it is very practical, so I share it with you as a reference. I hope you can get something after reading this article.

SNP2CAPS can convert SNP to CAPS tags, and its specific usage: perl SNP2CAPS.pl chr5D:9950377.fa_1 link_gcg AanI,AarI,AasI,AatII,Aba6411II,AbaB8342IV,AbaCIII > chr5D:9950377.txt, where.

SNP2CAPS converts SNP to CAPS tags, and its specific usage is:

Perl SNP2CAPS.pl chr5D:9950377.fa_1 link_gcg AanI,AarI,AasI,AatII,Aba6411II,AbaB8342IV,AbaCIII > chr5D:9950377.txt

Chr5D:9950377.fa_1 is the sequence of 150bp at both ends of SNP; link_gcg restriction endonuclease database; then is the list of restriction endonucleases used for analysis; chr5D:9950377.txt is the output file.

Chr5D:9950377.fa_1 example: > chr5D:9950377_RefACAACTTTATCTCGTATTTCATAGCAGTAGCCAACCAATCTTATGATATTTTGATGTTGGGCCCTCATAAGATTCAGAAGCTCATTCTTAAAACCAGCTTCGACTAGTCCGGGCTGGTTGTACAGTTTCTTCACGGCAATCACTTCCCCGTTATCAAGTACTCCCTGTTCAAAATCCCATGTTTAAAAGTAATAATGCAAGGGTTCAGGTAGCTAGTGTAGTGGTGGCATCTGTTTAAAAGTATTATTTTTTTCGTAAAATGCGCTTAATTTTCCTCCCAGCAACCTTTCCACCAACTGAT > chr5D:9950377_AltACAACTTTATCTCGTATTTCATAGCAGTAGCCAACCAATCTTATGATATTTTGATGTTGGGCCCTCATAAGATTCAGAAGCTCATTCTTAAAACCAGCTTCGACTAGTCCGGGCTGGTTGTACAGTTTCTTCACGGCAATCACTTCCCCGCTATCAAGTACTCCCTGTTCAAAATCCCATGTTTAAAAGTAATAATGCAAGGGTTCAGGTAGCTAGTGTAGTGGTGGCATCTGTTTAAAAGTATTATTTTTTTCGTAAAATGCGCTTAATTTTCCTCCCAGCAACCTTTCCACCAACTGAT

If you can't find the link_gcg file, you can download it here:

Link: https://pan.baidu.com/s/1eJGIOs2O8cULYbAbc83JCA password: ru01

Output file chr5D:9950377.txt example: # Marker Enzyme Total size Restriction Sites Expected Fragments MembersPredicted CAPS candidates-chr5D:9950377 AbaCIII 301 153 153148 Altchr5D:9950377 AbaCIII 301 301 Refchr5D:9950377 AciI 301 148153148 Altchr5D:9950377 AciI 301 301 Refchr5D:9950377 BscGI 301 301 Altchr5D:9950377 BscGI 301 148 153148 Refchr5D:9950377 BspACI 301 148 153148 Altchr5D:9950377 BspACI 301 301 Refchr5D:9950377 FauI 301 155 155146 Altchr5D:9950377 FauI 301 301 Refchr5D:9950377 LlaG50I 301 133 168133 Altchr5D:9950377 LlaG50I 301 133150 151,133,17 Refchr5D:9950377 SsiI 301 148 153148 Altchr5D:9950377 SsiI 301 301 RefFollowing markers could not be converted into CAPS

If there are many output files, there is a script that can extract enzyme information in batches, as follows.

#! / usr/bin/perl-wuse strict;use warnings;use Getopt::Long;use Config::General;use Cwd qw (abs_path getcwd); use FindBin qw ($Bin $Script); use File::Basename qw (basename dirname); use Bio::SeqIO;use Bio::Seq;my $version = "1.3" # # prepare parameters #- -# # GetOptionsmy% opts GetOptions (\% opts, "id=s", "od=s", "h"); my $od= $opts {od}; $od= abs_path ($od); my $id= $opts {id}; $id= abs_path ($id); open (OUT, "> $od/caps_out.txt") | | die "open $od/caps_out.txt failed\ n"; my @ sample = glob ("$id/*.txt"); foreach my $I (@ sample) {my $basename = basename ($I) Open (IN, "$I") | die "open $I failed\ n"; while () {next if (/ ^ S2C#Format:/); next if (/ ^ # /); next if (/ ^ Predicted CAPS candidates/); next if (/ ^-/); next if (/ ^ Following markers could not be converted into CAPS/); next if (/ ^ $/); next if (! /\ t /); print OUT $_;} close (IN);} close (OUT) This is the end of the article on "how to use SNP2CAPS in perl". I hope the above content can be of some help to you, so that you can learn more knowledge. if you think the article is good, please share it for more people to see.

Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.

Views: 0

*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

Share To

Development

Wechat

© 2024 shulou.com SLNews company. All rights reserved.

12
Report