Network Security Internet Technology Development Database Servers Mobile Phone Android Software Apple Software Computer Software News IT Information

In addition to Weibo, there is also WeChat

Please pay attention

WeChat public account

Shulou

How to use qiime2 Classifier to build SILVA Database

2026-04-04 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >

Share

Shulou(Shulou.com)06/01 Report--

This article mainly explains "how to use qiime2 classifier to establish SILVA database", interested friends may wish to take a look. The method introduced in this paper is simple, fast and practical. Let Xiaobian take you to learn "how to use qiime2 classifier to establish SILVA database"!

Using tools to establish database rescript

qiime rescript get-silva-data \--p-version '138' \ --p-target 'SSURef_NR99' \ --p-include-species-labels \ --o-silva-sequences silva-138-ssu-nr99-seqs.qza \ --o-silva-taxonomy silva-138-ssu-nr99-tax.qza

This code automatically obtains 99 similarity sequences and classification information, and generally runs an error due to network reasons

wget -c https://data.qiime2.org/2020.8/common/silva-138-99-seqs.qzawget -c https://data.qiime2.org/2020.8/common/silva-138-99-tax.qzaln -s silva-138-99-tax.qza silva-138-ssu-nr99-tax.qzaln -s silva-138-99-seqs.qza silva-138-ssu-nr99-seqs.qza#remove sequences that contain 5 or more ambiguous bases (IUPAC compliant ambiguity bases) and any homopolymers that are 8 or more bases in lengthqiime rescript cull-seqs \ --i-sequences silva-138-ssu-nr99-seqs.qza \ --o-clean-sequences silva-138-ssu-nr99-seqs-cleaned.qza#length filterqiime rescript filter-seqs-length-by-taxon \ --i-sequences silva-138-ssu-nr99-seqs-cleaned.qza \ --i-taxonomy silva-138-ssu-nr99-tax.qza \ --p-labels Archaea Bacteria Eukaryota \ --p-min-lens 900 1200 1400 \ --o-filtered-seqs silva-138-ssu-nr99-seqs-filt.qza \ --o-discarded-seqs silva-138-ssu-nr99-seqs-discard.qza#repeat sequence merge qiime rescript duplicate\ --i-sequences silva-138-ssu-nr99-seqs-filt.qza \ --i-taxa silva-138-ssu-nr99-tax.qza \ --p-rank-handles 'silva' \ --p-mode 'uniq' \ --o-dereplicated-sequences silva-138-ssu-nr99-seqs-derep-uniq.qza \ --o-deduplicated-taxa silva-138-ssu-nr99-tax-degenerate-uniq.qza#full-length classifier construction qiime feature-classifier fit-classifier-naive-bayes \ --i-reference-reads silva-138-ssu-nr99-seqs-degenerate-uniq. qza \ --i-reference-taxonomy silva-138-ssu-nr99-tax-degenerate-uniq.qza\ --o-classifier silva-138-ssu-nr 99-classifier.qza##specific primer classifier construction 1#intercept sequence qiime feature-classifier extract-reads \ --i-sequences silva-138-ssu-nr99-seqs-derep-uniq.qza \ --p-f-primer GTGYCAGCMGCCGCGGTAA \ --p-r-primer GGACTACNVGGGTWTCTAAT \ --p-n-jobs 2 \ --p-read-orientation 'forward' \ --o-reads silva-138-ssu-nr99-seqs-515f-806r.qza#merge duplicate qiime rescript duplicate\ --i-sequences silva-138-ssu-nr99-seqs-515f-806r.qza \ --i-taxa silva-138-ssu-nr99-tax-derep-uniq.qza \ --p-rank-handles 'silva' \ --p-mode 'uniq' \ --o-dereplicated-sequences silva-138-ssu-nr99-seqs-515f-806r-uniq.qza \ --o-deduplicated-taxa silva-138-ssu-nr99-tax-515f-806 r-deep-uniq.qza#build classifier qiime feature-classifier-naive-bayes \ --i-reference-reads silva-138-ssu-nr99-seqs-515f-806r-uniq.qza \ --i-reference-taxonomy silva-138-ssu-nr99-tax-515f-806r-derep-uniq.qza \ --o-classifier silva-138-ssu-nr99- 515f-806r-classifier.qza##specific primer classifier construct 2#338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and. 806R (5′-GGACTACHVGGGTWTCTAAT-3′)#intercept sequence qiime feature-classifier extract-reads \ --i-sequences silva-138-ssu-nr99-seqs-derep-uniq.qza \ --p-f-primer ACTCCTACGGGAGGCAGCAG \ --p-r-primer GGACTACHVGGGTWTCTAAT \ --p-n-jobs 2 \ --p-read-orientation 'forward' \ --o-reads silva-138-ssu-nr99-seqs-338f-806r.qza#merge duplicate qiime rescript duplicate\ --i-sequences silva-138-ssu-nr99-seqs-338f-806r.qza \ --i-taxa silva-138-ssu-nr99-tax-derep-uniq.qza \ --p-rank-handles 'silva' \ --p-mode 'uniq' \ --o-dereplicated-sequences silva-138-ssu-nr99-seqs-338f-806r-uniq.qza \ --o-deduplicated-taxa silva-138-ssu-nr99-tax-338f-806 r-deep-uniq.qza#build classifier qiime feature-classifier-naive-bayes \ --i-reference-reads silva-138-ssu-nr99-seqs-338f-806r-uniq.qza \ --i-reference-taxonomy silva-138-ssu-nr99-tax-338f-806r-derep-uniq.qza \ --o-classifier silva-138-ssu-nr99-338f-806r-classifier.qza

Note: qiime2 to establish a classification database is very expensive memory, at least 50G above

At this point, I believe that everyone has a deeper understanding of "how to use qiime2 classifier to establish SILVA database," may wish to actually operate it! Here is the website, more related content can enter the relevant channels for inquiry, pay attention to us, continue to learn!

Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.

Views: 0

*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

Share To

Development

Wechat

© 2024 shulou.com SLNews company. All rights reserved.

12
Report