In addition to Weibo, there is also WeChat
Please pay attention

WeChat public account
Shulou
2026-05-20 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >
Share
Shulou(Shulou.com)06/01 Report--
In this article, the editor introduces in detail "how to use qiime2 to split data on barcode information", the content is detailed, the steps are clear, and the details are handled properly. I hope that this article "how to use qiime2 to split data on barcode information" can help you solve your doubts.
First, prepare the sample-metadata.tsv file and the barcode file information of the sample. Here, take double-end sequencing as an example:
Sample-id forward-barcodes reverse-barcodesLin027 GATCTGCA CTACGATGLin028 GATCTGCA GACATAGCLin029 GATCTGCA GATCTGCALin032 GATCTGCA GCGTATGALin033 GATCTGCA GTATGCGA
To prepare the sequencing data, put the unsplit double-ended data into a directory: muxed-pe-barcode-in-seq, which is named forward.fastq.gz reverse.fastq.gz.
Data Import:
Qiime tools import-type MultiplexedPairedEndBarcodeInSequence\-input-path muxed-pe-barcode-in-seq\-output-path multiplexed-seqs.qza
Use the qiime cutadapt plug-in to split the data:
Qiime cutadapt demux-paired-- i-seqs multiplexed-seqs.qza\-- m-forward-barcodes-file sample-metadata.tsv\-- m-forward-barcodes-column forward-barcodes\-m-reverse-barcodes-file sample-metadata.tsv\-- m-reverse-barcodes-column reverse-barcodes\-- o-per-sample-sequences per_sample_sequences.qza\-- o-untrimmed-sequences untrimmed_sequences.qza
The per_sample_sequences.qza file is split data, and the barcode sequence has been removed.
If you want to remove primers, you can use:
Qiime cutadapt trim-paired\-- i-demultiplexed-sequences per_sample_sequences.qza\-- p-cores 4\-- p-no-indels\-- p-front-f ACTCCTACGGGAGGCAGCAG\-- p-front-r GGACTACHVGGGTWTCTAAT\-- o-trimmed-sequences primer-trimmed-demux.qza reads here, this article "how to use qiime2 to split barcode information into data" has been introduced. If you want to master the knowledge of this article, you still need to practice and use it. If you want to know more about the articles, you are welcome to follow the industry information channel.
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

The market share of Chrome browser on the desktop has exceeded 70%, and users are complaining about
The world's first 2nm mobile chip: Samsung Exynos 2600 is ready for mass production.According to a r
A US federal judge has ruled that Google can keep its Chrome browser, but it will be prohibited from
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope





About us Contact us Product review car news thenatureplanet
More Form oMedia: AutoTimes. Bestcoffee. SL News. Jarebook. Coffee Hunters. Sundaily. Modezone. NNB. Coffee. Game News. FrontStreet. GGAMEN
© 2024 shulou.com SLNews company. All rights reserved.