In addition to Weibo, there is also WeChat
Please pay attention

WeChat public account
Shulou
2026-04-03 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >
Share
Shulou(Shulou.com)06/01 Report--
In this article, the editor introduces "how to build qiime2 classifier" in detail, the content is detailed, the steps are clear, and the details are handled properly. I hope this article "how to build qiime2 classifier" can help you solve your doubts.
Construction of qiime2 18s Classifier
# # wget-c https://www.arb-silva.de/fileadmin/silva_databases/qiime/SILVA_132_QIIME_release.zip####unzip SILVA_132_QIIME_release.zipqiime tools import\-type 'FeatureData [Sequence]'\-input-path SILVA_132_QIIME_release/rep_set/rep_set_18S_only/99/silva_132_99_18S.fna\-output-path 18S_SILVA132_99_otus.qzaqiime tools import\ -- type 'FeatureData [Taxonomy]'\-input-format HeaderlessTSVTaxonomyFormat\-- input-path SILVA_132_QIIME_release/taxonomy/18S_only/99/majority_taxonomy_all_levels.txt\-- output-path 18S_SILVA132_99_taxonomy.qza# length filtering qiime rescript filter-seqs-length-by-taxon\-- i-sequences 18S_SILVA132_99_otus.qza\-- i-taxonomy 18S_SILVA132_99_taxonomy.qza\- -p-labels Eukaryota\-- p-min-lens 1400\-- o-filtered-seqs 18S_SILVA132_nr99-seqs-filt.qza\-- o-discarded-seqs 18S_SILVA132_nr99-seqs-discard.qza# repeat sequences merge qiime rescript dereplicate\-- i-sequences 18S_SILVA132_nr99-seqs-filt.qza\-- i-taxa 18S_SILVA132_99_taxonomy.qza\-- p-rank-handles' silva'\ -- p-mode 'uniq'\-- o-dereplicated-sequences 18S_SILVA132-nr99-seqs-derep-uniq.qza\-- o-dereplicated-taxa 18S_SILVA132-tax-derep-uniq.qza# full-length classifier to build qiime feature-classifier fit-classifier-naive-bayes\-- i-reference-reads 18S_SILVA132-nr99-seqs-derep-uniq.qza\-- i-reference-taxonomy 18S_SILVA132-nr99-tax-derep-uniq.qza\ -- o-classifier 18S_SILVA132-nr99-classifier.qza### http://www.earthmicrobiome.org/protocols-and-standards/18s/ 39qiime feature-classifier extract-reads\-- i-sequences 18S_SILVA132_99_otus.qza\-- p-f-primer GTACACACCGCCCGTC\-- p-r-primer TGATCCTTCTGCAGGTTCACCTAC\-- p-max-length 150\-- o-reads ref-seqs_18S_99_SILVA132_RL150.qzaqiime feature-classifier fit-classifier-naive-bayes \-i-reference-reads ref-seqs_18S_99_SILVA132_RL150.qza\-i-reference-taxonomy 18S_SILVA132_99_taxonomy.qza\-o-classifier 18S_EMB_SILVA132_classifier.qzaqiime feature-classifier fit-classifier-naive-bayes\-i-reference-reads 18S_SILVA132_99_otus.qza\-i-reference-taxonomy 18S_SILVA132_99_taxonomy.qza\-o-classifier 18S_full_SILVA132_classifier.qza read here This article "how to build qiime2 classifiers" has been introduced, and if you want to master the knowledge points of this article, you still need to practice and use it. If you want to know more about the article, please follow the industry information channel.
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

The market share of Chrome browser on the desktop has exceeded 70%, and users are complaining about
The world's first 2nm mobile chip: Samsung Exynos 2600 is ready for mass production.According to a r
A US federal judge has ruled that Google can keep its Chrome browser, but it will be prohibited from
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope





About us Contact us Product review car news thenatureplanet
More Form oMedia: AutoTimes. Bestcoffee. SL News. Jarebook. Coffee Hunters. Sundaily. Modezone. NNB. Coffee. Game News. FrontStreet. GGAMEN
© 2024 shulou.com SLNews company. All rights reserved.