In addition to Weibo, there is also WeChat
Please pay attention

WeChat public account
Shulou
2026-04-02 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >
Share
Shulou(Shulou.com)06/01 Report--
This article mainly introduces the relevant knowledge of how to use SNP_Primer_Pipeline, the content is detailed and easy to understand, the operation is simple and fast, and has a certain reference value. I believe you will gain something after reading this article on how to use SNP_Primer_Pipeline. Let's take a look at it.
Before doing dcaps markup, I only found the website version of the software at first, but later I found a good scripting software-- SNP_Primer_Pipeline.
The getCAPS-with-user-input.py can be used to design caps and dcaps marker primers at the same time.
Python getCAPS-with-user-input.py-I input.fa-t chr5D:9950377_Ref-p 301-r A-a C-m 1000
Where-I: input sequence;-t: target sequence;-p: SNP position;-r: ref;-a: alt;-m: price upper limit.
Input file:
> chr5D:9950377_RefTATCCATGCACATTAACATAGAAAAATTAAGTATAGAGGGTTGTCATGTATATACCGGAAAGAAGCTCCTCAAGGGTTCCACCCTGCATGTATTCCAAACATAGAGCTATTTCTTGCTCGTCAGCAACAACAAATCTCCCTTGGTACTCAACAACTTTATCTCGTATTTCATAGCAGTAGCCAACCAATCTTATGATATTTTGATGTTGGGCCCTCATAAGATTCAGAAGCTCATTCTTAAAACCAGCTTCGACTAGTCCGGGCTGGTTGTACAGTTTCTTCACGGCAATCACTTCCCCGTTATCAAGTACTCCCTGTTCAAAATCCCATGTTTAAAAGTAATAATGCAAGGGTTCAGGTAGCTAGTGTAGTGGTGGCATCTGTTTAAAAGTATTATTTTTTTCGTAAAATGCGCTTAATTTTCCTCCCAGCAACCTTTCCACCAACTGATGCACATATAACTTTGCGGTTGTAAAGTAGAAGATACAAGTAAATAATCATACTTCACACAAAAGCCTTAGAAACTACTCCCTATCCACCACAAACAATTATACGCTGCTTACAAAAATTAACGGGAGAGGAAATTACTGCCTTGGTGCTG
Output result:
Index product_size type start end diff_number 3'differall length Tm GCcontent any 3 'end_stability hairpin primer_seq ReverseComplement penalty compl_any compl_end PrimerID matched_chromosomesSNP-dCAPS-Hpy166II 68-gtnnac-303-0193 LEFT 135 156 0 YES 22 58.685 45.455 0.0 3.16 0.0 tctcccttggtactcaacaact agttgttgagtaccaagggaga 8.849723 4.48 2.64 L1SNP-dCAPS-Hpy166II 68-gtnnac-303-0193 RIGHT 327 303 0 YES 25 59.465 40.0 10.4910.49 2.83 0.0 ggattttgaacagggagtacttgTt aAcaagtactccctgttcaaaatcc 8.849723 4.48 2.64R1SNP-dCAPS-BsrBI 66-ccgctc-302-0192 LEFT 135 156 0 YES 22 58.685 45.455 0.0 3.16 0.0 tctcccttggtactcaacaact agttgttgagtaccaagggaga 9.545904 4.48 10.00 L1SNP-dCAPS-BsrBI 66-ccgctc-302-0192 RIGHT 326 302 0 YES 25 58.769 40.0 0.0 3.27 0.0 gattttgaacagggagtacttgaGa tCtcaagtactccctgttcaaaatc 9.545904 4.48 10.00 R6SNP-dCAPS-BsrI 63-ccagt-300-0161 LEFT 281 300 0 YES 20 60.322 55.0 0.0 4.45 0.0 tcacggcaatcacttcccAg cTgggaagtgattgccgtga 0.433976 13.96 13.96 L3SNP-dCAPS-BsrI 63-ccagt-300-0161 RIGHT 441 422 0 YES 20 59.888 55.0 0.0 3.36 0.0 ggaaaggttgctgggaggaa ttcctcccagcaacctttcc 0.433976 13.96 13.96 R2SNP-dCAPS-HpyCH4IV 132-acgt-299-0163 LEFT 279 299 0 YES 21 59.802 52.381 0.0 4.02 0.0 cttcacggcaatcacttccAc gTggaagtgattgccgtgaag 1.310133 17.97 12.50 L9SNP-dCAPS-HpyCH4IV 132-acgt-299-0163 RIGHT 441 422 0 YES 20 59.888 55.0 0.0 3.36 0.0 ggaaaggttgctgggaggaa ttcctcccagcaacctttcc 1.310133 17.97 12.50 R2SNP-dCAPS-Fnu4HI 330-gcngc-298-0163 LEFT 279 298 0 YES 20 60.179 55.0 0.0 0.0 4.7 0.0 cttcacggcaatcacttcGc gCgaagtgattgccgtgaag 0.291627 6.81 4.00 L8SNP-dCAPS-Fnu4HI 330-gcngc-298-0163 RIGHT 441 422 0 YES 20 59.888 55.0 0.0 3.36 0.0 ggaaaggttgctgggaggaa ttcctcccagcaacctttcc 0.291627 6.81 4.00 R2Sites that can differ all for SNPCAPS cut information for snp SNPEnzyme Enzyme_seq Change_pos Other_cut_posCac8I,710 gcnngc 295BseYI 412PsiI 660 cccagc 298 427HhaI HinP1 I gcgc 29 412PsiI 560 ttataa 304HpaIMagol 122 gttaac 303CviKI-1272 rgcy 298 361,229,262,514,105,210,179,246,64Hpy166II Magne68 gtnnac 303 this is the end of the article on how to use SNP_Primer_Pipeline. Thank you for reading! I believe you all have a certain understanding of the knowledge of "how to use SNP_Primer_Pipeline". If you want to learn more knowledge, you are welcome to follow the industry information channel.
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

The market share of Chrome browser on the desktop has exceeded 70%, and users are complaining about
The world's first 2nm mobile chip: Samsung Exynos 2600 is ready for mass production.According to a r
A US federal judge has ruled that Google can keep its Chrome browser, but it will be prohibited from
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope





About us Contact us Product review car news thenatureplanet
More Form oMedia: AutoTimes. Bestcoffee. SL News. Jarebook. Coffee Hunters. Sundaily. Modezone. NNB. Coffee. Game News. FrontStreet. GGAMEN
© 2024 shulou.com SLNews company. All rights reserved.