How to use SNP_Primer_Pipeline

This article mainly introduces the relevant knowledge of how to use SNP_Primer_Pipeline, the content is detailed and easy to understand, the operation is simple and fast, and has a certain reference value. I believe you will gain something after reading this article on how to use SNP_Primer_Pipeline. Let's take a look at it.

Before doing dcaps markup, I only found the website version of the software at first, but later I found a good scripting software-- SNP_Primer_Pipeline.

The getCAPS-with-user-input.py can be used to design caps and dcaps marker primers at the same time.

Python getCAPS-with-user-input.py-I input.fa-t chr5D:9950377_Ref-p 301-r A-a C-m 1000

Where-I: input sequence;-t: target sequence;-p: SNP position;-r: ref;-a: alt;-m: price upper limit.

Input file:

> chr5D:9950377_RefTATCCATGCACATTAACATAGAAAAATTAAGTATAGAGGGTTGTCATGTATATACCGGAAAGAAGCTCCTCAAGGGTTCCACCCTGCATGTATTCCAAACATAGAGCTATTTCTTGCTCGTCAGCAACAACAAATCTCCCTTGGTACTCAACAACTTTATCTCGTATTTCATAGCAGTAGCCAACCAATCTTATGATATTTTGATGTTGGGCCCTCATAAGATTCAGAAGCTCATTCTTAAAACCAGCTTCGACTAGTCCGGGCTGGTTGTACAGTTTCTTCACGGCAATCACTTCCCCGTTATCAAGTACTCCCTGTTCAAAATCCCATGTTTAAAAGTAATAATGCAAGGGTTCAGGTAGCTAGTGTAGTGGTGGCATCTGTTTAAAAGTATTATTTTTTTCGTAAAATGCGCTTAATTTTCCTCCCAGCAACCTTTCCACCAACTGATGCACATATAACTTTGCGGTTGTAAAGTAGAAGATACAAGTAAATAATCATACTTCACACAAAAGCCTTAGAAACTACTCCCTATCCACCACAAACAATTATACGCTGCTTACAAAAATTAACGGGAGAGGAAATTACTGCCTTGGTGCTG

Output result:

Index product_size type start end diff_number 3'differall length Tm GCcontent any 3 'end_stability hairpin primer_seq ReverseComplement penalty compl_any compl_end PrimerID matched_chromosomesSNP-dCAPS-Hpy166II 68-gtnnac-303-0193 LEFT 135 156 0 YES 22 58.685 45.455 0.0 3.16 0.0 tctcccttggtactcaacaact agttgttgagtaccaagggaga 8.849723 4.48 2.64 L1SNP-dCAPS-Hpy166II 68-gtnnac-303-0193 RIGHT 327 303 0 YES 25 59.465 40.0 10.4910.49 2.83 0.0 ggattttgaacagggagtacttgTt aAcaagtactccctgttcaaaatcc 8.849723 4.48 2.64R1SNP-dCAPS-BsrBI 66-ccgctc-302-0192 LEFT 135 156 0 YES 22 58.685 45.455 0.0 3.16 0.0 tctcccttggtactcaacaact agttgttgagtaccaagggaga 9.545904 4.48 10.00 L1SNP-dCAPS-BsrBI 66-ccgctc-302-0192 RIGHT 326 302 0 YES 25 58.769 40.0 0.0 3.27 0.0 gattttgaacagggagtacttgaGa tCtcaagtactccctgttcaaaatc 9.545904 4.48 10.00 R6SNP-dCAPS-BsrI 63-ccagt-300-0161 LEFT 281 300 0 YES 20 60.322 55.0 0.0 4.45 0.0 tcacggcaatcacttcccAg cTgggaagtgattgccgtga 0.433976 13.96 13.96 L3SNP-dCAPS-BsrI 63-ccagt-300-0161 RIGHT 441 422 0 YES 20 59.888 55.0 0.0 3.36 0.0 ggaaaggttgctgggaggaa ttcctcccagcaacctttcc 0.433976 13.96 13.96 R2SNP-dCAPS-HpyCH4IV 132-acgt-299-0163 LEFT 279 299 0 YES 21 59.802 52.381 0.0 4.02 0.0 cttcacggcaatcacttccAc gTggaagtgattgccgtgaag 1.310133 17.97 12.50 L9SNP-dCAPS-HpyCH4IV 132-acgt-299-0163 RIGHT 441 422 0 YES 20 59.888 55.0 0.0 3.36 0.0 ggaaaggttgctgggaggaa ttcctcccagcaacctttcc 1.310133 17.97 12.50 R2SNP-dCAPS-Fnu4HI 330-gcngc-298-0163 LEFT 279 298 0 YES 20 60.179 55.0 0.0 0.0 4.7 0.0 cttcacggcaatcacttcGc gCgaagtgattgccgtgaag 0.291627 6.81 4.00 L8SNP-dCAPS-Fnu4HI 330-gcngc-298-0163 RIGHT 441 422 0 YES 20 59.888 55.0 0.0 3.36 0.0 ggaaaggttgctgggaggaa ttcctcccagcaacctttcc 0.291627 6.81 4.00 R2Sites that can differ all for SNPCAPS cut information for snp SNPEnzyme Enzyme_seq Change_pos Other_cut_posCac8I,710 gcnngc 295BseYI 412PsiI 660 cccagc 298 427HhaI HinP1 I gcgc 29 412PsiI 560 ttataa 304HpaIMagol 122 gttaac 303CviKI-1272 rgcy 298 361,229,262,514,105,210,179,246,64Hpy166II Magne68 gtnnac 303 this is the end of the article on how to use SNP_Primer_Pipeline. Thank you for reading! I believe you all have a certain understanding of the knowledge of "how to use SNP_Primer_Pipeline". If you want to learn more knowledge, you are welcome to follow the industry information channel.