In addition to Weibo, there is also WeChat
Please pay attention
WeChat public account
Shulou
2025-08-05 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >
Share
Shulou(Shulou.com)06/01 Report--
This article introduces the relevant knowledge of "how to use samtools to intercept the sequence of a specified location". In the operation of actual cases, many people will encounter such a dilemma, so let the editor lead you to learn how to deal with these situations. I hope you can read it carefully and be able to achieve something!
Samtools faidx can create a file with the suffix .fai for the fasta sequence. According to this .fai file and the original fastsa file, it can quickly extract the sequence of any region.
Usage:
Samtools faidx input.fa
This command has certain requirements for the input fasta sequence: for each sequence, except for the last line, the length of other lines must be the same.
> one ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT > two another chromosome ATGCATGCATGCATGCATGCATGCATGC
The final generated .fai file is as follows, with 5 columns, separated by\ t
One 66 5 30 31two 28 98 14 15
The first column NAME: the name of the sequence, leaving only the contents after ">" and before the first blank.
The second column LENGTH: the length of the sequence in bp
The third column OFFSET: the offset of the first base, counted from 0, and the newline character also counted.
The fourth column LINEBASES: except for the last line, the base number of rows representing the sequence, in bp
The fifth column, LINEWIDTH: line width, except the last line, represents the length of the line of the sequence, including the newline character, which is\ r\ n in the windows system. Add 2 to the length of the sequence.
Extraction sequence:
Samtools faidx input.fa chr1 > chr1.fasamtools faidx input.fa chr1:100-200 > chr1.fa "how to use samtools to intercept the sequence of a specified location" is introduced here, thank you for reading. If you want to know more about the industry, you can follow the website, the editor will output more high-quality practical articles for you!
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope
"Every 5-10 years, there's a rare product, a really special, very unusual product that's the most un
© 2024 shulou.com SLNews company. All rights reserved.