How to extract the designated position sequence of Genome in batches by bedtools
Editor to share with you how bedtools batch extraction of the designated location of the genome sequence, I believe that most people do not know much about it, so share this article for your reference, I hope you can learn a lot after reading this article, let's learn about it!
The software used is bedtools, and the specific methods are as follows:
Usage: bedtools getfasta [OPTIONS]-fi-bed Options:-fi Input FASTA file-bed BED/GFF/VCF file of ranges to extract from-fi-name Use the name field for the FASTA header-split given BED12 fmt., extract and concatenate the sequencesfrom the BED "blocks" (e.g.exons)-tab Write output in TAB delimited format. -Default is FASTA format. -s Force strandedness. If the feature occupies the antisense, strand, the sequence will be reverse complemented. -By default, strand information is ignored. -fullHeader Use full fasta header. -By default, only the word before the first space or tab is used.
Where-fi specifies the genomic fasta file, and-bed specifies the location file to extract the sequence, which can be bed, gff, or vcf file (the chromosome base positions are counted from 0).
-tab specifies the output format.
$bedtools getfasta-fi GCA_001651475.1_Ler_Assembly_genomic.fna-bed id.bed > CM004359.1:0-10gtttagggtt > CM004359.1:100-200ttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggttt > CM004359.1:1000-1050TTGTGGgaaaattatttagttgtaGGGATGAAGTCTTTCTTCGTTGTTGT$bedtools getfasta-fi GCA_001651475.1_Ler_Assembly_genomic.fna-bed id.bed-tabCM004359.1:0-10gttta gggttCM004359.1:100-200ttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttCM004359.1:1000-1050TTGTGGgaaaattatttagttgtaGGGATGAAGTCTTTCTTCGTTGTTGT is all the contents of the article "how to extract the designated location sequence of the genome in batch". Thank you for reading! I believe we all have a certain understanding, hope to share the content to help you, if you want to learn more knowledge, welcome to follow the industry information channel!
