In addition to Weibo, there is also WeChat
Please pay attention
WeChat public account
Shulou
2025-06-17 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >
Share
Shulou(Shulou.com)06/01 Report--
Editor to share with you how bedtools batch extraction of the designated location of the genome sequence, I believe that most people do not know much about it, so share this article for your reference, I hope you can learn a lot after reading this article, let's learn about it!
The software used is bedtools, and the specific methods are as follows:
Usage: bedtools getfasta [OPTIONS]-fi-bed Options:-fi Input FASTA file-bed BED/GFF/VCF file of ranges to extract from-fi-name Use the name field for the FASTA header-split given BED12 fmt., extract and concatenate the sequencesfrom the BED "blocks" (e.g.exons)-tab Write output in TAB delimited format. -Default is FASTA format. -s Force strandedness. If the feature occupies the antisense, strand, the sequence will be reverse complemented. -By default, strand information is ignored. -fullHeader Use full fasta header. -By default, only the word before the first space or tab is used.
Where-fi specifies the genomic fasta file, and-bed specifies the location file to extract the sequence, which can be bed, gff, or vcf file (the chromosome base positions are counted from 0).
-tab specifies the output format.
$bedtools getfasta-fi GCA_001651475.1_Ler_Assembly_genomic.fna-bed id.bed > CM004359.1:0-10gtttagggtt > CM004359.1:100-200ttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggttt > CM004359.1:1000-1050TTGTGGgaaaattatttagttgtaGGGATGAAGTCTTTCTTCGTTGTTGT$bedtools getfasta-fi GCA_001651475.1_Ler_Assembly_genomic.fna-bed id.bed-tabCM004359.1:0-10gttta gggttCM004359.1:100-200ttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttagggtttCM004359.1:1000-1050TTGTGGgaaaattatttagttgtaGGGATGAAGTCTTTCTTCGTTGTTGT is all the contents of the article "how to extract the designated location sequence of the genome in batch". Thank you for reading! I believe we all have a certain understanding, hope to share the content to help you, if you want to learn more knowledge, welcome to follow the industry information channel!
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope
"Every 5-10 years, there's a rare product, a really special, very unusual product that's the most un
© 2024 shulou.com SLNews company. All rights reserved.